refine.bio
  • Search
      • Normalized Compendia
      • RNA-seq Sample Compendia
  • Docs
  • About
  • My Dataset
github link
Showing
of 2713 results
Sort by

Filters

Technology

Platform

accession-icon GSE50002
Effect of Twist-box mutation on gene expression induced by Twist1 overexpression
  • organism-icon Mus musculus
  • sample-icon 15 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Gene 1.0 ST Array (mogene10st)

Description

Twist1 is a transcription factor that induces EMT and drives metastasis in prostate cancer. We examined global gene expression in Myc-CaP mouse prostate cancer cells following overexpression

Publication Title

The twist box domain is required for Twist1-induced prostate cancer metastasis.

Alternate Accession IDs

E-GEOD-50002

Sample Metadata Fields

Cell line

View Samples
accession-icon GSE50658
Two faces of polarized macrophages: differential effects of M1 and M2 macrophage subtypes on lung cancer progression
  • organism-icon Homo sapiens
  • sample-icon 14 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)

Description

Macrophages in tumor microenvironment have been characterized as M1- and M2-polarized subtypes. This study sought to investigate the effects of different macrophage subtypes on the biological behavior and global gene expression profiles of lung cancer cells. Expression microarray and bioinformatics analyses indicated that the different macrophage subtypes mainly regulated genes involved in cell cycle, cytoskeletal remodeling, coagulation, cell adhesion and apoptosis pathways in A549 cells, a pattern that correlated with the altered behavior of A549 cells observed after coculture with macrophage subtypes.

Publication Title

Opposite Effects of M1 and M2 Macrophage Subtypes on Lung Cancer Progression.

Alternate Accession IDs

E-GEOD-50658

Sample Metadata Fields

Specimen part, Cell line

View Samples
accession-icon GSE16014
Expression data from effects of Ganoderma lucidum polysaccharides F3 on human monocytic leukemia cell line THP-1
  • organism-icon Homo sapiens
  • sample-icon 6 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Genome U133A Array (hgu133a)

Description

In order to identify patterns of gene expression associated with biological effects in THP-1 cells induced by F3, we performed a transcriptomic analysis on the THP-1 control and F3-treated THP-1 cells by oligonucleotide microarray

Publication Title

Ganoderma lucidum polysaccharides in human monocytic leukemia cells: from gene expression to network construction.

Alternate Accession IDs

E-GEOD-16014

Sample Metadata Fields

Cell line

View Samples
accession-icon SRP074231
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and –independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency
  • organism-icon Mus musculus
  • sample-icon 6 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2500

Description

Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6

Publication Title

Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

Alternate Accession IDs

GSE80972

Sample Metadata Fields

Specimen part, Subject

View Samples
accession-icon GSE38678
Cancer-Associated Fibroblasts Support Lung Cancer Stemness through Paracrine IGF-II/IGF1R/Nanog Signaling
  • organism-icon Homo sapiens
  • sample-icon 11 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)

Description

The CLS1/CAF co-culture maintained the cancer stemness. This cancer stemness was lost when the CAF feeder cells were removed during passaging.

Publication Title

Cancer-associated fibroblasts regulate the plasticity of lung cancer stemness via paracrine signalling.

Alternate Accession IDs

E-GEOD-38678

Sample Metadata Fields

Cell line

View Samples
accession-icon GSE92342
BRCA1 Represses DNA Replication Fork Firing and Prevents Mitotic Catastrophe through Antagonizing Estrogen Signaling during Pregnancy
  • organism-icon Mus musculus
  • sample-icon 24 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Gene 2.0 ST Array (mogene20st)

Description

The mammary gland at early stages of pregnancy undergoes fast cell proliferation, yet the mechanism to ensure its genome integrity is largely unknown. Here we show that pregnancy enhances expression of genes involved in numerous pathways, including most genes encoding replisomes. In mouse mammary glands, replisome genes are positively regulated by estrogen/ERa signaling but negatively regulated by BRCA1. Upon DNA damage, BRCA1 deficiency markedly enhances DNA replication initiation. BRCA1 deficiency also preferably impairs DNA replication checkpoints mediated by ATR and CHK1 but not by WEE1, which inhibits DNA replication initiation through CDC7-MCM2 pathway and enables BRCA1-deficient cells to avoid further genomic instability. Thus, BRCA1 and WEE1 inhibit DNA replication initiation in a parallel manner to ensure genome stability for mammary gland development during pregnancy.

Publication Title

BRCA1 represses DNA replication initiation through antagonizing estrogen signaling and maintains genome stability in parallel with WEE1-MCM2 signaling during pregnancy.

Alternate Accession IDs

E-GEOD-92342

Sample Metadata Fields

No sample metadata fields

View Samples
accession-icon SRP050988
Transcriptome analyses of dBRWD3 mutant, and dBRWD3, yem double mutant brain
  • organism-icon Drosophila melanogaster
  • sample-icon 3 Downloadable Samples
  • Technology Badge IconIon Torrent Proton

Description

We report the high-throughput profiling of brain RNA from three Drosophila stains: dBRWD3PX2/+, dBRWD3PX2/PX2 and dBRWD3PX2/PX2, yemGS21861/GS21861. By obtaining over 50 million reads of sequence, WE compared the transcriptomic differences among the brains from these three stains. We found that the expression of 871 genes was significantly different between heterozygous control and homozygous dBRWD3 mutant brains (484 upregulated genes, 387 downregulated genes, p<0.05). Gene ontology (GO) analysis of the 871 genes revealed a broad spectrum of biological processes, ranging from synaptic activity to housekeeping metabolism subjective to dBRWD3 regulation. Among the 387 downregulated genes, the expression of 360 genes (92.8%) was increased in the dBRWD3, yem double mutant brains compared with dBRWD3 mutant. Among the 484 upregulated genes, the expression of 412 genes (85.1%) was decreased in the double mutant brains. These differential genes were evenly distributed on X chromosome and autosomes (149 on X, 178 on 2L, 154 on 2R, 166 on 3L, and 207 on 3R). These analyses indicate that dBRWD3 regulates gene expression in the brain mainly through the HIRA/YEM complex. Overall design: Examination of brain transcriptome in 3 Drosophila strains.

Publication Title

Intellectual disability-associated dBRWD3 regulates gene expression through inhibition of HIRA/YEM-mediated chromatin deposition of histone H3.3.

Alternate Accession IDs

GSE64009

Sample Metadata Fields

Specimen part, Cell line, Subject

View Samples
accession-icon GSE109336
lncRNA LINC00844 regulates prostste cancer cell migration and invasion through AR signaling
  • organism-icon Homo sapiens
  • sample-icon 18 Downloadable Samples
  • Technology Badge IconIllumina HumanHT-12 V4.0 expression beadchip

Description

The majority of the human genome is transcribed, yielding a rich repository of non-coding transcripts that are involved in a myriad of biological processes including cancer. However, how non-coding transcripts such as Long Non-coding RNAs (lncRNAs) function in prostate cancer is still unclear. In this study, we have identified a novel set of clinically relevant androgen-regulated lncRNAs in prostate cancer. Among this group, we found LINC00844 is a direct androgen regulated target that is actively transcribed in AR-dependent prostate cancer cells. In clinical analysis, the expression of LINC00844 is higher in normal prostate compared to malignant and metastatic prostate cancer samples and patients with low expression demonstrate poor prognosis and significantly increased biochemical recurrence suggesting LINC00844 may function in suppressing tumor progression and metastasis. From in-vitroloss-of-function studies, we showed LINC00844 prevents prostate cancer cell migration and invasion. Moreover, in gene expression studies we demonstrate LINC00844 functions in trans, affecting global androgen-regulated gene transcription. Mechanistically, we provide evidence to show LINC00844 is important in facilitating AR binding to the chromatin. Finally, we showed LINC00844 mediates its phenotypic effects in part by activating the expression of NDRG1, a crucial cancer metastasis suppressor. Collectively, our findings indicate LINC00844 is a novel coregulator of AR that plays an important role in the androgen transcriptional network and the development and progression of prostate cancer.

Publication Title

Novel lncRNA &lt;i&gt;LINC00844&lt;/i&gt; Regulates Prostate Cancer Cell Migration and Invasion through AR Signaling.

Alternate Accession IDs

E-GEOD-109336

Sample Metadata Fields

Cell line, Treatment

View Samples
accession-icon GSE24587
EpsteinBarr virus (EBV) Rta-mediated cell cycle arrest enables permissive replication of EBV and Kaposis sarcoma-associated herpesvirus in 293 cells
  • organism-icon Homo sapiens
  • sample-icon 7 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Gene 1.0 ST Array (hugene10st)

Description

Epstein-Barr virus (EBV) Rta is a latent-lytic molecular switch evolutionarily conserved in all gamma-herpesviruses. In previous studies, doxycycline-inducible Rta was shown to potently produce an irreversible G1 arrest followed by cellular senescence in 293 cells. Here, we demonstrate that in this system the inducible Rta not only reactivates resident genome of EBV but also that of Kaposis sarcoma-associated herpesvirus (KSHV), to similar efficiency. However, Rta-induced senescence program was terminated by the robust viral lytic cycle replication that eventually caused cell death. Furthermore, prior to the abrupt expression of immediate-early protein (EBV BZLF1 or KSHV RTA), Rta simultaneously down-regulates cell cycle activators (c-Myc, CDK6, CCND2) and up-regulates senescence-related genes (p21, 14-3-3s). Since Rta is a viral immediate-early transcriptional activator, it is envisioned that during the initial stage of viral reactivation, Rta may engage to modulate the host transcriptome, to halt cell cycle progression, and to maintain an ideal environment for manufacturing infectious virions.

Publication Title

Epstein-Barr virus (EBV) Rta-mediated EBV and Kaposi's sarcoma-associated herpesvirus lytic reactivations in 293 cells.

Alternate Accession IDs

E-GEOD-24587

Sample Metadata Fields

Specimen part, Cell line

View Samples
accession-icon GSE24585
Expression profiling of host genes modulated by Epstein-Barr virus (EBV) Rta in HEK293 cells
  • organism-icon Homo sapiens
  • sample-icon 4 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Gene 1.0 ST Array (hugene10st)

Description

EBV Rta is a transcriptional activator that functions to disrupt EBV latency in cells of epithelial origin. This series of experiment is to identify host genes that are moduated by the expression of doxycycline-inducible EBV Rta in HEK293 cells. Designations for the pooled EBV Rta inducible cell lines is 293TetER; pooled luciferase inducible lines is 293TetLuc (control).

Publication Title

Epstein-Barr virus (EBV) Rta-mediated EBV and Kaposi's sarcoma-associated herpesvirus lytic reactivations in 293 cells.

Alternate Accession IDs

E-GEOD-24585

Sample Metadata Fields

Specimen part, Cell line

View Samples
...

refine.bio is a repository of uniformly processed and normalized, ready-to-use transcriptome data from publicly available sources. refine.bio is a project of the Childhood Cancer Data Lab (CCDL)

fund-icon Fund the CCDL

Developed by the Childhood Cancer Data Lab

Powered by Alex's Lemonade Stand Foundation

Cite refine.bio

Casey S. Greene, Dongbo Hu, Richard W. W. Jones, Stephanie Liu, David S. Mejia, Rob Patro, Stephen R. Piccolo, Ariel Rodriguez Romero, Hirak Sarkar, Candace L. Savonen, Jaclyn N. Taroni, William E. Vauclain, Deepashree Venkatesh Prasad, Kurt G. Wheeler. refine.bio: a resource of uniformly processed publicly available gene expression datasets.
URL: https://www.refine.bio

Note that the contributor list is in alphabetical order as we prepare a manuscript for submission.

BSD 3-Clause LicensePrivacyTerms of UseContact