refine.bio
  • Search
      • Normalized Compendia
      • RNA-seq Sample Compendia
  • Docs
  • About
  • My Dataset
github link
Showing
of 111 results
Sort by

Filters

Technology

Platform

accession-icon GSE80654
FACS sorting of human adipose tissue stromal vascular fraction
  • organism-icon Homo sapiens
  • sample-icon 51 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Transcriptome Array 2.0 (hta20)

Description

Adipose tissue from 6 non-obese patients was collagenase treated and adipocytes separated from the stromal vascular fraction(SVF). SVF was then FACS sorted for the following fractions CD45-/CD34+/CD31+ (endothelial), CD45-/CD34+/CD31- (progenitor), CD45+/CD14+ (monocyte/macrophage), CD45+/CD14-(Leukocyte). RNA was isolated from adipocyte, SVF, progenitor, macrophage/monocyte and leukocyte fractions and analyzed on the Affymetrix Human Transcriptome 2.0 array. We also sorted SVF from an additional 13 (10 non-obese, 9 obese) patients and sent progenitor RNA for Affymetrix Human Transcriptome 2.0 array analysis.

Publication Title

The cell-type specific transcriptome in human adipose tissue and influence of obesity on adipocyte progenitors.

Alternate Accession IDs

E-GEOD-80654

Sample Metadata Fields

Sex, Specimen part, Subject

View Samples
accession-icon GSE54890
Early B-cell Factor 1 Regulates Adipocyte Morphology and Lipolysis in White Adipose Tissue
  • organism-icon Homo sapiens
  • sample-icon 9 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2000, Affymetrix Human Gene 1.1 ST Array (hugene11st)

Description

This SuperSeries is composed of the SubSeries listed below.

Publication Title

Early B cell factor 1 regulates adipocyte morphology and lipolysis in white adipose tissue.

Alternate Accession IDs

E-GEOD-54890

Sample Metadata Fields

Specimen part

View Samples
accession-icon GSE42680
Early B-cell Factor 1 Regulates Adipocyte Morphology and Lipolysis in White Adipose Tissue [expression profiling]
  • organism-icon Homo sapiens
  • sample-icon 9 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Gene 1.1 ST Array (hugene11st), Illumina HiSeq 2000

Description

To investgate the role of EBF1 in human adipocyte, we performed global expression profiling in human adipocytes transfected with siRNA targeting EBF1.

Publication Title

Early B cell factor 1 regulates adipocyte morphology and lipolysis in white adipose tissue.

Alternate Accession IDs

E-GEOD-42680

Sample Metadata Fields

Specimen part

View Samples
accession-icon SRP066955
RNA-Seq of Lgr6 positive and negative cells in mouse mammary gland
  • organism-icon Mus musculus
  • sample-icon 4 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 4000

Description

Lgr6-positive cells have been shown to label stem/progenitors cells in several tissues including tongue and skin. However their role in mammary gland has never been investigated. Here we used Lgr6-eGFP-IRES-CreER2 mice to isolate and characterize Lgr6-positive population in mammary gland of 5-week old female mice. Overall design: Examination of transcriptional differences between Lgr6 positive and negative cells

Publication Title

Lgr6 labels a rare population of mammary gland progenitor cells that are able to originate luminal mammary tumours.

Alternate Accession IDs

GSE75648

Sample Metadata Fields

Sex, Specimen part, Subject

View Samples
accession-icon SRP100835
Assessing the impact of the R252W Charcot-Marie-Tooth disease mutation in MORC2 on HUSH-mediated repression
  • organism-icon Homo sapiens
  • sample-icon 3 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2500

Description

HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.

Publication Title

Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.

Alternate Accession IDs

GSE95455

Sample Metadata Fields

Cell line, Subject

View Samples
accession-icon GSE13379
Application of a translational profiling approach for the comparative analysis of CNS cell types.
  • organism-icon Mus musculus
  • sample-icon 107 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Genome 430 2.0 Array (mouse4302)

Description

Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.

Publication Title

Application of a translational profiling approach for the comparative analysis of CNS cell types.

Alternate Accession IDs

E-GEOD-13379

Sample Metadata Fields

No sample metadata fields

View Samples
accession-icon GSE99927
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
  • organism-icon Mus musculus
  • sample-icon 4 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Genome 430 2.0 Array (mouse4302)

Description

We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.

Publication Title

Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.

Alternate Accession IDs

E-GEOD-99927

Sample Metadata Fields

Sex, Specimen part

View Samples
accession-icon SRP058841
Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)
  • organism-icon Homo sapiens
  • sample-icon 18 Downloadable Samples
  • Technology Badge IconIlluminaHiSeq2500

Description

Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

Publication Title

Tunable protein synthesis by transcript isoforms in human cells.

Alternate Accession IDs

GSE69352

Sample Metadata Fields

No sample metadata fields

View Samples
accession-icon SRP072980
Stochastic Principles Governing Alternative Splicing of RNA
  • organism-icon Homo sapiens
  • sample-icon 72 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2000

Description

The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.

Publication Title

Stochastic principles governing alternative splicing of RNA.

Alternate Accession IDs

GSE80016

Sample Metadata Fields

Subject

View Samples
accession-icon E-MEXP-110
Transcription profiling of adult male whole MutaMouse lung with its immortalized 100% confluent epithelial lung cell line counterpart (Affymetrix)
  • organism-icon Mus musculus
  • sample-icon 9 Downloadable Samples
  • Technology Badge Icon Affymetrix Murine Genome U74A Version 2 Array (mgu74av2), Affymetrix Murine Genome U74A Array (mgu74a)

Description

Biological comparison of gene expression profiles of adult male whole Muta™Mouse lung with its immortalized 100% confluent epithelial lung cell line counterpart. White, P.A.,et al. 2003. Development and characterization of an epithelial cell line from Muta™Mouse lung. Environ Mol Mutagen 42,3 pgs 166-184

Publication Title

Comprehensive comparison of six microarray technologies.

Alternate Accession IDs

None

Sample Metadata Fields

Sex, Specimen part, Cell line, Subject

View Samples
...

refine.bio is a repository of uniformly processed and normalized, ready-to-use transcriptome data from publicly available sources. refine.bio is a project of the Childhood Cancer Data Lab (CCDL)

fund-icon Fund the CCDL

Developed by the Childhood Cancer Data Lab

Powered by Alex's Lemonade Stand Foundation

Cite refine.bio

Casey S. Greene, Dongbo Hu, Richard W. W. Jones, Stephanie Liu, David S. Mejia, Rob Patro, Stephen R. Piccolo, Ariel Rodriguez Romero, Hirak Sarkar, Candace L. Savonen, Jaclyn N. Taroni, William E. Vauclain, Deepashree Venkatesh Prasad, Kurt G. Wheeler. refine.bio: a resource of uniformly processed publicly available gene expression datasets.
URL: https://www.refine.bio

Note that the contributor list is in alphabetical order as we prepare a manuscript for submission.

BSD 3-Clause LicensePrivacyTerms of UseContact