refine.bio
  • Search
      • Normalized Compendia
      • RNA-seq Sample Compendia
  • Docs
  • About
  • My Dataset
github link
Showing
of 111 results
Sort by

Filters

Technology

Platform

accession-icon GSE107859
Transcriptomic analysis of glioblastoma cells bearing different IRE1a mutants
  • organism-icon Homo sapiens
  • sample-icon 40 Downloadable Samples
  • Technology Badge Icon Affymetrix HT HG-U133+ PM Array Plate (hthgu133pluspm)

Description

Glioblastoma multiforme is the most lethal form of glioma with an overall survival at 5 years nearly null, which mainly results from acquired resistance to therapies. Large scale sequencing studies on human cancer biopsies defined IRE1alpha as the fifth most oncogenic mutated kinase in human cancer. IRE1alpha is a major component of the Unfolded Protein Response signaling and increasing evidence suggests that it is a central player in GBM development.

Publication Title

Dual IRE1 RNase functions dictate glioblastoma development.

Alternate Accession IDs

E-GEOD-107859

Sample Metadata Fields

Specimen part, Cell line

View Samples
accession-icon GSE48655
Expression data from growth restricted fetal rat pancreatic islets
  • organism-icon Rattus norvegicus
  • sample-icon 8 Downloadable Samples
  • Technology Badge Icon Affymetrix Rat Gene 1.0 ST Array (ragene10st)

Description

Intrauterine growth restriction is a common complication of pregnancy. We induce IUGR in rats by bilateral uterine artery ligation at e18 of a 23 day gestation.

Publication Title

Neutralizing Th2 inflammation in neonatal islets prevents β-cell failure in adult IUGR rats.

Alternate Accession IDs

E-GEOD-48655

Sample Metadata Fields

Specimen part, Treatment

View Samples
accession-icon SRP100835
Assessing the impact of the R252W Charcot-Marie-Tooth disease mutation in MORC2 on HUSH-mediated repression
  • organism-icon Homo sapiens
  • sample-icon 3 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2500

Description

HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.

Publication Title

Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.

Alternate Accession IDs

GSE95455

Sample Metadata Fields

Cell line, Subject

View Samples
accession-icon GSE49938
Re-specification of myeloid precursors from human pluripotent cells into engraftable multi-lineage progenitors
  • organism-icon Homo sapiens
  • sample-icon 28 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)

Description

Human pluripotent stem cells were differentiated into hematopoietic progenitors, which were then re-specified using defined transcription factors to resemble hematopoietic stem cells (HSC)

Publication Title

Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via respecification of lineage-restricted precursors.

Alternate Accession IDs

E-GEOD-49938

Sample Metadata Fields

Specimen part

View Samples
accession-icon GSE13379
Application of a translational profiling approach for the comparative analysis of CNS cell types.
  • organism-icon Mus musculus
  • sample-icon 107 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Genome 430 2.0 Array (mouse4302)

Description

Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.

Publication Title

Application of a translational profiling approach for the comparative analysis of CNS cell types.

Alternate Accession IDs

E-GEOD-13379

Sample Metadata Fields

No sample metadata fields

View Samples
accession-icon GSE18476
Gene Expression Data from U937T:PLZF-RARa Inducible Cells
  • organism-icon Homo sapiens
  • sample-icon 6 Downloadable Samples
  • Technology Badge Icon Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)

Description

The PLZF-RARa fusion oncoprotein is overexpressed in the t(11;17) subtype of acute promyelocytic leukemia. Gene expression microarrays were used to identify genes involved in leukemic transformation.

Publication Title

Comprehensive genomic screens identify a role for PLZF-RARalpha as a positive regulator of cell proliferation via direct regulation of c-MYC.

Alternate Accession IDs

E-GEOD-18476

Sample Metadata Fields

Cell line

View Samples
accession-icon GSE99927
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
  • organism-icon Mus musculus
  • sample-icon 4 Downloadable Samples
  • Technology Badge Icon Affymetrix Mouse Genome 430 2.0 Array (mouse4302)

Description

We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.

Publication Title

Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.

Alternate Accession IDs

E-GEOD-99927

Sample Metadata Fields

Sex, Specimen part

View Samples
accession-icon SRP080883
inDrop single cell RNA-seq of hematopoietic cells derived from human pluripotent stem cells
  • organism-icon Homo sapiens
  • sample-icon 4 Downloadable Samples
  • Technology Badge IconNextSeq 500

Description

We performed morphogen-directed differentiation of human PSCs into HE followed by combinatorial screening of 26 candidate HSC-specifying TFs for the potential to promote hematopoietic engraftment in irradiated immune deficient murine hosts. We recovered seven TFs (ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1) that together were sufficient to convert HE into hematopoietic stem and progenitor cells (HSPCs) that engraft primary and secondary murine recipients Overall design: Examination of expression pattern in hematopoietic cells.

Publication Title

Haematopoietic stem and progenitor cells from human pluripotent stem cells.

Alternate Accession IDs

GSE85111

Sample Metadata Fields

Specimen part, Subject

View Samples
accession-icon SRP058841
Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)
  • organism-icon Homo sapiens
  • sample-icon 18 Downloadable Samples
  • Technology Badge IconIlluminaHiSeq2500

Description

Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

Publication Title

Tunable protein synthesis by transcript isoforms in human cells.

Alternate Accession IDs

GSE69352

Sample Metadata Fields

No sample metadata fields

View Samples
accession-icon SRP136698
A CLK3-HMGA2 alternative splicing axis impacts human hematopoietic stem cell molecular identity throughout development (HPC-5F RNAseq)
  • organism-icon Homo sapiens
  • sample-icon 8 Downloadable Samples
  • Technology Badge IconIllumina HiSeq 2500

Description

While gene expression dynamics have been extensively catalogued during hematopoietic differentiation in the adult, less is known about transcriptome diversity of human hematopoietic stem cells (HSCs) during development. To characterize transcriptional and post-transcriptional changes in HSCs during development, we leveraged high-throughput genomic approaches to profile miRNAs, lincRNAs, and mRNAs. Our findings indicate that HSCs manifest distinct alternative splicing patterns in key hematopoietic regulators. Detailed analysis of the splicing dynamics and function of one such regulator, HMGA2, identified an alternative isoform that escapes miRNA-mediated targeting. We further identified the splicing kinase CLK3 that, by regulating HMGA2 splicing, preserves HMGA2 function in the setting of an increase in let-7 miRNA levels, delineating how CLK3 and HMGA2 form a functional axis that influences HSC properties during development. Collectively, our study highlights molecular mechanisms by which alternative splicing and miRNA-mediated post-transcriptional regulation impact the molecular identity and stage-specific developmental features of human HSCs. Overall design: RNA-seq of HPC-5F cells transduced with a control (CTRL), HMGA2-L (LONG), HMGA2-S (SHORT) or CLK3 ORF lentiviral over-expression vectors.

Publication Title

A CLK3-HMGA2 Alternative Splicing Axis Impacts Human Hematopoietic Stem Cell Molecular Identity throughout Development.

Alternate Accession IDs

GSE112486

Sample Metadata Fields

Specimen part, Subject

View Samples
...

refine.bio is a repository of uniformly processed and normalized, ready-to-use transcriptome data from publicly available sources. refine.bio is a project of the Childhood Cancer Data Lab (CCDL)

fund-icon Fund the CCDL

Developed by the Childhood Cancer Data Lab

Powered by Alex's Lemonade Stand Foundation

Cite refine.bio

Casey S. Greene, Dongbo Hu, Richard W. W. Jones, Stephanie Liu, David S. Mejia, Rob Patro, Stephen R. Piccolo, Ariel Rodriguez Romero, Hirak Sarkar, Candace L. Savonen, Jaclyn N. Taroni, William E. Vauclain, Deepashree Venkatesh Prasad, Kurt G. Wheeler. refine.bio: a resource of uniformly processed publicly available gene expression datasets.
URL: https://www.refine.bio

Note that the contributor list is in alphabetical order as we prepare a manuscript for submission.

BSD 3-Clause LicensePrivacyTerms of UseContact